View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_165 (Length: 251)
Name: NF0908_low_165
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_165 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 147; Significance: 1e-77; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 147; E-Value: 1e-77
Query Start/End: Original strand, 13 - 163
Target Start/End: Complemental strand, 47440370 - 47440220
Alignment:
Q |
13 |
aatatgttttgcctggtttttctttgacaagctttgcctgcaggttaggctctaagatccaaatagcattaccagtttctagactctcatgacttaaaga |
112 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
47440370 |
aatatgttttgcctggtttttctttgacaagctttgcctgcaggttaggctctaagatccaaatagcattaccagtttctagactctcatgacttaaaga |
47440271 |
T |
 |
Q |
113 |
attcaaaagaatattaacttcgtagttgtttcctaaccttatccatcggtt |
163 |
Q |
|
|
|||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
T |
47440270 |
attcaaaagaatattaacttcgtatttgtttcctaaccttatccatcggtt |
47440220 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 327 times since January 2019
Visitors: 6696