View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_166 (Length: 250)
Name: NF0908_low_166
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_166 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 224; Significance: 1e-123; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 224; E-Value: 1e-123
Query Start/End: Original strand, 2 - 241
Target Start/End: Original strand, 33153466 - 33153705
Alignment:
Q |
2 |
gtgcggatttacttaacgagatccaaggtagaattcttgagctgaagagagaaaggcaagtagcttcttgtattggaatttcgcaaatgaattaacagga |
101 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33153466 |
gtgcggatttacttaacgagatccaaggtagaattattgatctgaagagaaaaaggcaagtagcttcttgtattggaatttcgcaaatgaattaacagga |
33153565 |
T |
 |
Q |
102 |
ttctgcataagttttggtggcactttgggtttcagttcttggatgtaggtaatttgatagtattttttggttttgggctggttaagaaaatgtttatcaa |
201 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||| |
|
|
T |
33153566 |
ttctgcataagttttggtggcactttgggtttcagttcttggatgtaggtaatttgatagtattttttgtttttgggctggttaagaaaatgtttatcaa |
33153665 |
T |
 |
Q |
202 |
atgtatcatcatgttaacatgtatgtttatcaattcatct |
241 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
T |
33153666 |
atgtatcatcatgttaacatgtatgtttatcaattcatct |
33153705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 87; Significance: 8e-42; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 87; E-Value: 8e-42
Query Start/End: Original strand, 92 - 225
Target Start/End: Original strand, 25081080 - 25081213
Alignment:
Q |
92 |
attaacaggattctgcataagttttggtggcactttgggtttcagttcttggatgtaggtaatttgatagtattttttggttttgggctggttaagaaaa |
191 |
Q |
|
|
||||||||||||||||||||||||||||||||||| ||||||||||||| |||||| |||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
25081080 |
attaacaggattctgcataagttttggtggcacttcgggtttcagttctaggatgttggtaatttgatagtattttt-ggttttgggctggttaagaaat |
25081178 |
T |
 |
Q |
192 |
tgtttatcaa-atgtatcatcatgttaacatgtat |
225 |
Q |
|
|
||||||| |||||| ||||||||||||||||| |
|
|
T |
25081179 |
tgtttatatctatgtattatcatgttaacatgtat |
25081213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University