View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_171 (Length: 243)

Name: NF0908_low_171
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_171
NF0908_low_171
[»] chr8 (2 HSPs)
chr8 (20-154)||(11826269-11826403)
chr8 (24-154)||(23094197-23094327)
[»] chr7 (1 HSPs)
chr7 (20-153)||(47347557-47347690)


Alignment Details
Target: chr8 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 20 - 154
Target Start/End: Original strand, 11826269 - 11826403
Alignment:
20 aaaaacattctgttttagatattgatgtcaatagggatataaacctggatattgaaccagtaagaggtgcctaaaatgattaactgtatgtctagtttca 119  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||    
11826269 aaaaacattctgttttagatattgatgtcaatagggatataaacctggatattgaaccggtaagaggtgcctaaaatgattaactgtatgtctagtttca 11826368  T
120 tgcatagaacaggttaacttgtactaatatctgat 154  Q
    ||| |||||||||||||||||||||||||||||||    
11826369 tgcctagaacaggttaacttgtactaatatctgat 11826403  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 24 - 154
Target Start/End: Original strand, 23094197 - 23094327
Alignment:
24 acattctgttttagatattgatgtcaatagggatataaacctggatattgaaccagtaagaggtgcctaaaatgattaactgtatgtctagtttcatgca 123  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
23094197 acattctgttttagatattgatgtgaatagggatataaacctggatattgaaccagtaagaggtgcctaaaatgattaactgtatgtctagtttcatgca 23094296  T
124 tagaacaggttaacttgtactaatatctgat 154  Q
    |||||||||||||||||||||||||||||||    
23094297 tagaacaggttaacttgtactaatatctgat 23094327  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 98; Significance: 2e-48; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 98; E-Value: 2e-48
Query Start/End: Original strand, 20 - 153
Target Start/End: Complemental strand, 47347690 - 47347557
Alignment:
20 aaaaacattctgttttagatattgatgtcaatagggatataaacctggatattgaaccagtaagaggtgcctaaaatgattaactgtatgtctagtttca 119  Q
    ||||||||||| |||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||| || ||||||||||||     
47347690 aaaaacattcttttttagatattgatgtcaatagggatataaacctggatgttgaaccggtaagaggtgcctaaaatgattaattgcatgtctagtttct 47347591  T
120 tgcatagaacaggttaacttgtactaatatctga 153  Q
    ||| |||| ||| |||||||||||||||||||||    
47347590 tgcctagagcagattaacttgtactaatatctga 47347557  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 330 times since January 2019
Visitors: 6696