View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_183 (Length: 227)
Name: NF0908_low_183
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_183 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 64; Significance: 4e-28; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 156 - 219
Target Start/End: Original strand, 48666403 - 48666466
Alignment:
Q |
156 |
aaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
219 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48666403 |
aaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
48666466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 163 - 219
Target Start/End: Original strand, 48655834 - 48655890
Alignment:
Q |
163 |
actgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
219 |
Q |
|
|
||||| |||||||| ||||| ||| ||||| ||||||||||||||||| ||||||| |
|
|
T |
48655834 |
actgcatcctccgctgccttcttccacttgattgcatttttcttcaactcctctgct |
48655890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 500 times since January 2019
Visitors: 6696