View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_187 (Length: 221)
Name: NF0908_low_187
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_187 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 21123460 - 21123592
Alignment:
| Q |
1 |
aatcagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtcc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21123460 |
aatcagttaatgtaattcatggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgtttttcggtgattctggtggtcc |
21123559 |
T |
 |
| Q |
101 |
gtctattgaggatcttggtcaccgtgctggata |
133 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| |
|
|
| T |
21123560 |
ttctattgaggatcttggtcaccatgctggata |
21123592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 4 - 121
Target Start/End: Original strand, 21143386 - 21143503
Alignment:
| Q |
4 |
cagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtc |
103 |
Q |
| |
|
|||||||| ||||||| |||||||| ||| ||||||||||| | || ||||| |||||||||||||||||||||||||| |||||||| |||||| || |
|
|
| T |
21143386 |
cagttaatataattcatggtgatcactctattgatcattttgtccctggaaaactcgtcgagaagaagttctcgttttttagtgattctaatggtccttc |
21143485 |
T |
 |
| Q |
104 |
tattgaggatcttggtca |
121 |
Q |
| |
|
|||||| ||||||||||| |
|
|
| T |
21143486 |
tattgaagatcttggtca |
21143503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 33 - 133
Target Start/End: Original strand, 21149226 - 21149326
Alignment:
| Q |
33 |
cttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtctattgaggatcttggtcaccgtgctggat |
132 |
Q |
| |
|
|||||| ||||| | || ||||||||||| ||||| |||||||||||||||||| |||||| ||| | |||||||| |||||||||||| ||| |||| |
|
|
| T |
21149226 |
cttgatgattttgtccctggaaagatcgtggagaaaaagttctcgttttttggtcattctgatgggctttctattgataatcttggtcaccatgccggat |
21149325 |
T |
 |
| Q |
133 |
a |
133 |
Q |
| |
|
| |
|
|
| T |
21149326 |
a |
21149326 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University