View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_190 (Length: 216)

Name: NF0908_low_190
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_190
NF0908_low_190
[»] chr4 (3 HSPs)
chr4 (1-133)||(21123460-21123592)
chr4 (4-121)||(21143386-21143503)
chr4 (33-133)||(21149226-21149326)


Alignment Details
Target: chr4 (Bit Score: 117; Significance: 9e-60; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 117; E-Value: 9e-60
Query Start/End: Original strand, 1 - 133
Target Start/End: Original strand, 21123460 - 21123592
Alignment:
1 aatcagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtcc 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
21123460 aatcagttaatgtaattcatggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgtttttcggtgattctggtggtcc 21123559  T
101 gtctattgaggatcttggtcaccgtgctggata 133  Q
     |||||||||||||||||||||| |||||||||    
21123560 ttctattgaggatcttggtcaccatgctggata 21123592  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 4 - 121
Target Start/End: Original strand, 21143386 - 21143503
Alignment:
4 cagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtc 103  Q
    |||||||| ||||||| |||||||| ||| ||||||||||| | || |||||  |||||||||||||||||||||||||| ||||||||  |||||| ||    
21143386 cagttaatataattcatggtgatcactctattgatcattttgtccctggaaaactcgtcgagaagaagttctcgttttttagtgattctaatggtccttc 21143485  T
104 tattgaggatcttggtca 121  Q
    |||||| |||||||||||    
21143486 tattgaagatcttggtca 21143503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 41; E-Value: 0.00000000000002
Query Start/End: Original strand, 33 - 133
Target Start/End: Original strand, 21149226 - 21149326
Alignment:
33 cttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtctattgaggatcttggtcaccgtgctggat 132  Q
    |||||| ||||| | || ||||||||||| ||||| |||||||||||||||||| |||||| ||| |  ||||||||  |||||||||||| ||| ||||    
21149226 cttgatgattttgtccctggaaagatcgtggagaaaaagttctcgttttttggtcattctgatgggctttctattgataatcttggtcaccatgccggat 21149325  T
133 a 133  Q
    |    
21149326 a 21149326  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University