View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_193 (Length: 216)
Name: NF0908_low_193
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_193 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 21123460 - 21123599
Alignment:
| Q |
1 |
aatcagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtcc |
100 |
Q |
| |
|
||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
21123460 |
aatcagttaatgtaattcatggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgtttttcggtgattctggtggtcc |
21123559 |
T |
 |
| Q |
101 |
gtctattgaggatcttggtcaccatgctggatattattcg |
140 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
21123560 |
ttctattgaggatcttggtcaccatgctggatactattcg |
21123599 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 4 - 133
Target Start/End: Original strand, 21143386 - 21143515
Alignment:
| Q |
4 |
cagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtc |
103 |
Q |
| |
|
|||||||| ||||||| |||||||| ||| ||||||||||| | || ||||| |||||||||||||||||||||||||| |||||||| |||||| || |
|
|
| T |
21143386 |
cagttaatataattcatggtgatcactctattgatcattttgtccctggaaaactcgtcgagaagaagttctcgttttttagtgattctaatggtccttc |
21143485 |
T |
 |
| Q |
104 |
tattgaggatcttggtcaccatgctggata |
133 |
Q |
| |
|
|||||| ||||||||||| ||||| ||||| |
|
|
| T |
21143486 |
tattgaagatcttggtcatcatgccggata |
21143515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 33 - 139
Target Start/End: Original strand, 21149226 - 21149332
Alignment:
| Q |
33 |
cttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtctattgaggatcttggtcaccatgctggat |
132 |
Q |
| |
|
|||||| ||||| | || ||||||||||| ||||| |||||||||||||||||| |||||| ||| | |||||||| |||||||||||||||| |||| |
|
|
| T |
21149226 |
cttgatgattttgtccctggaaagatcgtggagaaaaagttctcgttttttggtcattctgatgggctttctattgataatcttggtcaccatgccggat |
21149325 |
T |
 |
| Q |
133 |
attattc |
139 |
Q |
| |
|
| ||||| |
|
|
| T |
21149326 |
actattc |
21149332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University