View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_193 (Length: 216)

Name: NF0908_low_193
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_193
NF0908_low_193
[»] chr4 (3 HSPs)
chr4 (1-140)||(21123460-21123599)
chr4 (4-133)||(21143386-21143515)
chr4 (33-139)||(21149226-21149332)


Alignment Details
Target: chr4 (Bit Score: 124; Significance: 6e-64; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 124; E-Value: 6e-64
Query Start/End: Original strand, 1 - 140
Target Start/End: Original strand, 21123460 - 21123599
Alignment:
1 aatcagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtcc 100  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||    
21123460 aatcagttaatgtaattcatggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgtttttcggtgattctggtggtcc 21123559  T
101 gtctattgaggatcttggtcaccatgctggatattattcg 140  Q
     |||||||||||||||||||||||||||||||| ||||||    
21123560 ttctattgaggatcttggtcaccatgctggatactattcg 21123599  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 4 - 133
Target Start/End: Original strand, 21143386 - 21143515
Alignment:
4 cagttaatgtaattcacggtgatcattctcttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtc 103  Q
    |||||||| ||||||| |||||||| ||| ||||||||||| | || |||||  |||||||||||||||||||||||||| ||||||||  |||||| ||    
21143386 cagttaatataattcatggtgatcactctattgatcattttgtccctggaaaactcgtcgagaagaagttctcgttttttagtgattctaatggtccttc 21143485  T
104 tattgaggatcttggtcaccatgctggata 133  Q
    |||||| ||||||||||| ||||| |||||    
21143486 tattgaagatcttggtcatcatgccggata 21143515  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 47; E-Value: 5e-18
Query Start/End: Original strand, 33 - 139
Target Start/End: Original strand, 21149226 - 21149332
Alignment:
33 cttgatcattttctacccggaaagatcgtcgagaagaagttctcgttttttggtgattctggtggtccgtctattgaggatcttggtcaccatgctggat 132  Q
    |||||| ||||| | || ||||||||||| ||||| |||||||||||||||||| |||||| ||| |  ||||||||  |||||||||||||||| ||||    
21149226 cttgatgattttgtccctggaaagatcgtggagaaaaagttctcgttttttggtcattctgatgggctttctattgataatcttggtcaccatgccggat 21149325  T
133 attattc 139  Q
    | |||||    
21149326 actattc 21149332  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 289 times since January 2019
Visitors: 6696