View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_197 (Length: 215)

Name: NF0908_low_197
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_197
NF0908_low_197
[»] chr1 (1 HSPs)
chr1 (1-55)||(48666397-48666451)


Alignment Details
Target: chr1 (Bit Score: 55; Significance: 9e-23; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 55
Target Start/End: Complemental strand, 48666451 - 48666397
Alignment:
1 gaaaaatgcaaccaagttgaaaaaggcggcggaggaagcagtggcggttggtggt 55  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48666451 gaaaaatgcaaccaagttgaaaaaggcggcggaggaagcagtggcggttggtggt 48666397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University