View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_200 (Length: 213)
Name: NF0908_low_200
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_200 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 81; Significance: 3e-38; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 1 - 128
Target Start/End: Original strand, 26020761 - 26020893
Alignment:
| Q |
1 |
tgtttgacaaaattgtattattatatttcacccttaaattggctaatgttatgtg-----atattacacaagtacaatttgtgtgtttcctcgtagatgg |
95 |
Q |
| |
|
||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||| || |||||||| |||||| |||||||||||| ||||||| |
|
|
| T |
26020761 |
tgtttgacaaaattgtattattatatttcacacttaaattggccaatgttaagtgacattatgttacacaaatacaatccgtgtgtttcctcatagatgg |
26020860 |
T |
|
| Q |
96 |
acacgcatcataaacttcgataaaaacatacat |
128 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
26020861 |
acacgcatcataaacttcgataaaaacatacat |
26020893 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 1 - 126
Target Start/End: Complemental strand, 26229316 - 26229186
Alignment:
| Q |
1 |
tgtttgacaaaattgtattattatatttcacccttaaattggctaatgttatgtg-----atattacacaagtacaatttgtgtgtttcctcgtagatgg |
95 |
Q |
| |
|
||||||| ||||||||||| | ||||||||| |||||||||| ||||||||||| || |||||||||| |||| |||||||||||| ||||||| |
|
|
| T |
26229316 |
tgtttgataaaattgtattgtcatatttcacatttaaattggccaatgttatgtgacattatgttacacaagtgcaatccgtgtgtttcctcatagatgg |
26229217 |
T |
|
| Q |
96 |
acacgcatcataaacttcgataaaaacatac |
126 |
Q |
| |
|
|||||| ||||||||| | |||||||||||| |
|
|
| T |
26229216 |
acacgcgtcataaactccaataaaaacatac |
26229186 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 811 times since January 2019
Visitors: 6696