View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_206 (Length: 208)
Name: NF0908_low_206
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_206 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 96; Significance: 3e-47; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 1 - 104
Target Start/End: Original strand, 7372705 - 7372808
Alignment:
| Q |
1 |
tcataagaacgctattgtcctctatgttttagtttaagtggatgatattttgattaatactccacctcttctcgtaatctcattcaagatctcactcaca |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||| |
|
|
| T |
7372705 |
tcataagaacgctattgtcctctatgttttagtttaagtggatgatattttgattaatactccacttcttctcgtaatctcattcaagatctcattcaca |
7372804 |
T |
|
| Q |
101 |
gctg |
104 |
Q |
| |
|
|||| |
|
|
| T |
7372805 |
gctg |
7372808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 451 times since January 2019
Visitors: 6696