View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_207 (Length: 208)
Name: NF0908_low_207
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_207 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 155
Target Start/End: Complemental strand, 14844350 - 14844210
Alignment:
| Q |
15 |
ctgtgataaaacaaacatcaggcagactgtaacaactacatttatggtagatctctagaaatttatatccacgtgtgtactaaatgatgtaatccttaat |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844350 |
ctgtgataaaacaaacatcaggcagactgtaacaactacatttatggtagatctctagaaatttatatccacgtgtgtactaaatgatgtaatccttaat |
14844251 |
T |
|
| Q |
115 |
atcagaatttagacaccagccaagtaaaatatataacttag |
155 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844250 |
atcagaatttagacaccagccaagtaaaatatataacttag |
14844210 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 495 times since January 2019
Visitors: 6696