View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_207 (Length: 208)

Name: NF0908_low_207
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_207
NF0908_low_207
[»] chr5 (1 HSPs)
chr5 (15-155)||(14844210-14844350)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 4e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 4e-74
Query Start/End: Original strand, 15 - 155
Target Start/End: Complemental strand, 14844350 - 14844210
Alignment:
15 ctgtgataaaacaaacatcaggcagactgtaacaactacatttatggtagatctctagaaatttatatccacgtgtgtactaaatgatgtaatccttaat 114  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14844350 ctgtgataaaacaaacatcaggcagactgtaacaactacatttatggtagatctctagaaatttatatccacgtgtgtactaaatgatgtaatccttaat 14844251  T
115 atcagaatttagacaccagccaagtaaaatatataacttag 155  Q
    |||||||||||||||||||||||||||||||||||||||||    
14844250 atcagaatttagacaccagccaagtaaaatatataacttag 14844210  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University