View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_208 (Length: 206)
Name: NF0908_low_208
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_208 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 121; Significance: 3e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 121; E-Value: 3e-62
Query Start/End: Original strand, 1 - 129
Target Start/End: Complemental strand, 30877943 - 30877815
Alignment:
| Q |
1 |
aaacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaa |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
30877943 |
aaacacctctccttattccattgtttccaaggttgtctcctgtgtttggtccccacaaacaactctcctttttcatttctcttttcactttgctatggaa |
30877844 |
T |
|
| Q |
101 |
atggaaggttatgatattgttggagatgc |
129 |
Q |
| |
|
||||||||||||||||| |||||||||| |
|
|
| T |
30877843 |
atggaaggttatgatatatttggagatgc |
30877815 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 380 times since January 2019
Visitors: 6696