View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_210 (Length: 203)
Name: NF0908_low_210
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_210 |
 |  |
|
[»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 48666398 - 48666463
Alignment:
Q |
138 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctct |
203 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
48666398 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctct |
48666463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 48628155 - 48628214
Alignment:
Q |
138 |
ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaac |
197 |
Q |
|
|
|||||||| |||||||||||||| ||| |||| ||| |||| ||||||||||||||||| |
|
|
T |
48628155 |
ccaccaacggccactgcttcctctgcctccttcttccacttcattgcatttttcttcaac |
48628214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University