View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_210 (Length: 203)

Name: NF0908_low_210
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_210
NF0908_low_210
[»] chr1 (2 HSPs)
chr1 (138-203)||(48666398-48666463)
chr1 (138-197)||(48628155-48628214)


Alignment Details
Target: chr1 (Bit Score: 66; Significance: 2e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 66; E-Value: 2e-29
Query Start/End: Original strand, 138 - 203
Target Start/End: Original strand, 48666398 - 48666463
Alignment:
138 ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctct 203  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
48666398 ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctct 48666463  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 138 - 197
Target Start/End: Original strand, 48628155 - 48628214
Alignment:
138 ccaccaaccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaac 197  Q
    |||||||| |||||||||||||| ||| |||| ||| ||||  |||||||||||||||||    
48628155 ccaccaacggccactgcttcctctgcctccttcttccacttcattgcatttttcttcaac 48628214  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University