View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_211 (Length: 203)
Name: NF0908_low_211
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_211 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 61; Significance: 2e-26; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 61; E-Value: 2e-26
Query Start/End: Original strand, 3 - 67
Target Start/End: Complemental strand, 14201081 - 14201017
Alignment:
| Q |
3 |
ccaccaagatcttcaaacaaggcttctaaacctccgttaccgtctctgtcaaaatcagcatctgt |
67 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
14201081 |
ccaccaagatcttcaaacaaggcttctaaacctccattaccgtctctgtcaaaatcagcatctgt |
14201017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University