View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_212 (Length: 203)
Name: NF0908_low_212
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_212 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 130; Significance: 1e-67; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 130; E-Value: 1e-67
Query Start/End: Original strand, 16 - 197
Target Start/End: Original strand, 7372631 - 7372808
Alignment:
Q |
16 |
atgaatgctcgatatcttttttgcttcaaattggtttaggcgcagcggatgtgatccatctctcctcannnnnnnncttcataggaacgctattgtcctc |
115 |
Q |
|
|
|||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |||||| |||||||||||||||| |
|
|
T |
7372631 |
atgaatgctcaatatcttttttgcttcaaattggtttaggcgcagcggatgtgatccatctcttctcattttt----ttcataagaacgctattgtcctc |
7372726 |
T |
 |
Q |
116 |
tatgttttagtttaagtggatgatattttgattaatactccacctcttctcgtaatctcattcaagatctcactcacagctg |
197 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| ||||||||| |
|
|
T |
7372727 |
tatgttttagtttaagtggatgatattttgattaatactccacttcttctcgtaatctcattcaagatctcattcacagctg |
7372808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 474 times since January 2019
Visitors: 6704