View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_222 (Length: 201)
Name: NF0908_low_222
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_222 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 5e-27; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 5e-27
Query Start/End: Original strand, 135 - 196
Target Start/End: Original strand, 48666405 - 48666466
Alignment:
| Q |
135 |
ccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
48666405 |
ccgccactgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
48666466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 140 - 196
Target Start/End: Original strand, 48655834 - 48655890
Alignment:
| Q |
140 |
actgcttcctccgccgcctttttcaacttggttgcatttttcttcaacgtctctgct |
196 |
Q |
| |
|
||||| |||||||| ||||| ||| ||||| ||||||||||||||||| ||||||| |
|
|
| T |
48655834 |
actgcatcctccgctgccttcttccacttgattgcatttttcttcaactcctctgct |
48655890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 32; Significance: 0.000000004; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 32; E-Value: 0.000000004
Query Start/End: Original strand, 1 - 88
Target Start/End: Complemental strand, 36170904 - 36170817
Alignment:
| Q |
1 |
acttgacaacatcaaaactatctatctttttgtccgttcccaccacaatttcctcttctggctgcagcttgagtttcgctttcttttt |
88 |
Q |
| |
|
||||||||||| |||||||||||| | || ||| ||| || ||||||||||||||||| || || ||| ||||| ||||||||||| |
|
|
| T |
36170904 |
acttgacaacagcaaaactatctaacccttcgtctgtttcctccacaatttcctcttctttcttcatctttagttttgctttcttttt |
36170817 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University