View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_36 (Length: 446)
Name: NF0908_low_36
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_36 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 141; Significance: 9e-74; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 7 - 147
Target Start/End: Original strand, 14844210 - 14844350
Alignment:
| Q |
7 |
ctaagttatatattttacttggctggtgtctaaattctgatattaaggattacatcatttagtacacacgtggatataaatttctagagatctaccataa |
106 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844210 |
ctaagttatatattttacttggctggtgtctaaattctgatattaaggattacatcatttagtacacacgtggatataaatttctagagatctaccataa |
14844309 |
T |
 |
| Q |
107 |
atgtagttgttacagtctgcctgatgtttgttttatcacag |
147 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
14844310 |
atgtagttgttacagtctgcctgatgtttgttttatcacag |
14844350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University