View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_36 (Length: 446)

Name: NF0908_low_36
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_36
NF0908_low_36
[»] chr5 (1 HSPs)
chr5 (7-147)||(14844210-14844350)


Alignment Details
Target: chr5 (Bit Score: 141; Significance: 9e-74; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 141; E-Value: 9e-74
Query Start/End: Original strand, 7 - 147
Target Start/End: Original strand, 14844210 - 14844350
Alignment:
7 ctaagttatatattttacttggctggtgtctaaattctgatattaaggattacatcatttagtacacacgtggatataaatttctagagatctaccataa 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
14844210 ctaagttatatattttacttggctggtgtctaaattctgatattaaggattacatcatttagtacacacgtggatataaatttctagagatctaccataa 14844309  T
107 atgtagttgttacagtctgcctgatgtttgttttatcacag 147  Q
    |||||||||||||||||||||||||||||||||||||||||    
14844310 atgtagttgttacagtctgcctgatgtttgttttatcacag 14844350  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 107 times since January 2019
Visitors: 6700