View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0908_low_39 (Length: 433)

Name: NF0908_low_39
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0908_low_39
NF0908_low_39
[»] chr5 (3 HSPs)
chr5 (263-361)||(32916496-32916594)
chr5 (127-235)||(32916622-32916730)
chr5 (31-99)||(32916832-32916900)
[»] chr2 (1 HSPs)
chr2 (107-168)||(6144429-6144490)
[»] chr4 (1 HSPs)
chr4 (112-156)||(16008498-16008542)


Alignment Details
Target: chr5 (Bit Score: 91; Significance: 6e-44; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 263 - 361
Target Start/End: Complemental strand, 32916594 - 32916496
Alignment:
263 atgggtttgcagctttggtgcctctagaggaattaagggagataaactttacaaagcaatatgggattgctaaggatcctgaagtcatagatattcttg 361  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||    
32916594 atgggtttgcagctttggtgcctctagaggaattaagagagataaacttcacaaagcaatatgggattgctaaggatcctgaagtcatagatattcttg 32916496  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 32916730 - 32916622
Alignment:
127 aaaatcttgatgttgcagcccagattgcaatcatggatttttgtttttaaaccttggttggcacatactatatgttaggaaatgataaagttgtgcttat 226  Q
    ||||||||||| | |||||||||||||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||||    
32916730 aaaatcttgatatagcagcccagattgcaatcatggatttttgtttttaaaccttgcttagcacatactatatgttaggaaatgataaagttgtgcttat 32916631  T
227 gcagtatga 235  Q
    |||| ||||    
32916630 gcagcatga 32916622  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 32916900 - 32916832
Alignment:
31 tggactgggccgcaacatcagggtttcaatgtctctacgaccataattgaggcaaaatcgattataatt 99  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| |||||||    
32916900 tggactgggccgcgacatcagggtttcaatgtctctacgaccataattgaggcaaaatcgactataatt 32916832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 168
Target Start/End: Complemental strand, 6144490 - 6144429
Alignment:
107 ttgccgttgttgagacatcaaaaatcttgatgttgcagcccagattgcaatcatggattttt 168  Q
    |||| ||||| || |||||||||| ||| |||| ||||| ||||||||||||||||| ||||    
6144490 ttgcagttgtggatacatcaaaaaacttaatgtcgcagctcagattgcaatcatggactttt 6144429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 156
Target Start/End: Complemental strand, 16008542 - 16008498
Alignment:
112 gttgttgagacatcaaaaatcttgatgttgcagcccagattgcaa 156  Q
    ||||||||||||||||||||| | | || ||||||||||||||||    
16008542 gttgttgagacatcaaaaatcataacgtcgcagcccagattgcaa 16008498  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University