View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_39 (Length: 433)
Name: NF0908_low_39
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_39 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 91; Significance: 6e-44; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 91; E-Value: 6e-44
Query Start/End: Original strand, 263 - 361
Target Start/End: Complemental strand, 32916594 - 32916496
Alignment:
| Q |
263 |
atgggtttgcagctttggtgcctctagaggaattaagggagataaactttacaaagcaatatgggattgctaaggatcctgaagtcatagatattcttg |
361 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32916594 |
atgggtttgcagctttggtgcctctagaggaattaagagagataaacttcacaaagcaatatgggattgctaaggatcctgaagtcatagatattcttg |
32916496 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 89; E-Value: 9e-43
Query Start/End: Original strand, 127 - 235
Target Start/End: Complemental strand, 32916730 - 32916622
Alignment:
| Q |
127 |
aaaatcttgatgttgcagcccagattgcaatcatggatttttgtttttaaaccttggttggcacatactatatgttaggaaatgataaagttgtgcttat |
226 |
Q |
| |
|
||||||||||| | |||||||||||||||||||||||||||||||||||||||||| || |||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32916730 |
aaaatcttgatatagcagcccagattgcaatcatggatttttgtttttaaaccttgcttagcacatactatatgttaggaaatgataaagttgtgcttat |
32916631 |
T |
|
| Q |
227 |
gcagtatga |
235 |
Q |
| |
|
|||| |||| |
|
|
| T |
32916630 |
gcagcatga |
32916622 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 61; E-Value: 5e-26
Query Start/End: Original strand, 31 - 99
Target Start/End: Complemental strand, 32916900 - 32916832
Alignment:
| Q |
31 |
tggactgggccgcaacatcagggtttcaatgtctctacgaccataattgaggcaaaatcgattataatt |
99 |
Q |
| |
|
||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
| T |
32916900 |
tggactgggccgcgacatcagggtttcaatgtctctacgaccataattgaggcaaaatcgactataatt |
32916832 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 30; Significance: 0.0000002; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 30; E-Value: 0.0000002
Query Start/End: Original strand, 107 - 168
Target Start/End: Complemental strand, 6144490 - 6144429
Alignment:
| Q |
107 |
ttgccgttgttgagacatcaaaaatcttgatgttgcagcccagattgcaatcatggattttt |
168 |
Q |
| |
|
|||| ||||| || |||||||||| ||| |||| ||||| ||||||||||||||||| |||| |
|
|
| T |
6144490 |
ttgcagttgtggatacatcaaaaaacttaatgtcgcagctcagattgcaatcatggactttt |
6144429 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000006; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000006
Query Start/End: Original strand, 112 - 156
Target Start/End: Complemental strand, 16008542 - 16008498
Alignment:
| Q |
112 |
gttgttgagacatcaaaaatcttgatgttgcagcccagattgcaa |
156 |
Q |
| |
|
||||||||||||||||||||| | | || |||||||||||||||| |
|
|
| T |
16008542 |
gttgttgagacatcaaaaatcataacgtcgcagcccagattgcaa |
16008498 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 244 times since January 2019
Visitors: 6695