View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_54 (Length: 378)
Name: NF0908_low_54
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_54 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 97 - 308
Target Start/End: Original strand, 9222723 - 9222932
Alignment:
| Q |
97 |
gtcttttatatcaatttaaagtttaaactcatatgatgagatagataaaaatttagaccatatagaattatgacggtgtctctattattttggatatttg |
196 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
9222723 |
gtcttttatatcaatttaaagtttaaactcatacgatgagatagataaaaatttagaccatatagaattatgacggtgtct--attattttggatatttg |
9222820 |
T |
 |
| Q |
197 |
aaaaatttagccaatacacaattactttatgtgctaaaacacaaacttttataggtaaattattgttgccaccgtaatttatgtcactaacgagaatgca |
296 |
Q |
| |
|
|||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
9222821 |
aaaaatttagccaatacaaaattactttatgtgctaaaacacaaacttttataggtaaattattgttgccaccgtaatttatgtcactaaccagaatgca |
9222920 |
T |
 |
| Q |
297 |
aaaatattgttg |
308 |
Q |
| |
|
|||||||||||| |
|
|
| T |
9222921 |
aaaatattgttg |
9222932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University