View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_56 (Length: 373)
Name: NF0908_low_56
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_56 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 79; Significance: 7e-37; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 7e-37
Query Start/End: Original strand, 87 - 173
Target Start/End: Original strand, 40677382 - 40677468
Alignment:
Q |
87 |
agcacagagagaacacaatgtaaacaaaacataatggttaacacaaacttcatgcttatttgcaacgcgcatattagcaacacacgt |
173 |
Q |
|
|
|||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
40677382 |
agcatagagagaacacaatataaacaaaacataatggttaacacaaacttcatgcttatttgcaacgcgcatattagcaacacacgt |
40677468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 270
Target Start/End: Original strand, 40677525 - 40677559
Alignment:
Q |
236 |
ccacaatacaaataagtaaaccctactggatagca |
270 |
Q |
|
|
||||||||||||||||||||||||||||||||||| |
|
|
T |
40677525 |
ccacaatacaaataagtaaaccctactggatagca |
40677559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 538 times since January 2019
Visitors: 6704