View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_63 (Length: 366)
Name: NF0908_low_63
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0908_low_63 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 3e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 3e-98
Query Start/End: Original strand, 86 - 295
Target Start/End: Complemental strand, 362555 - 362351
Alignment:
Q |
86 |
ttatctggaatgtcccttatctcaccaaccgaacgcgagacaaatagaataaaatacggattaaatgtacttagttaggaagatgtttttataattgttg |
185 |
Q |
|
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||| |
|
|
T |
362555 |
ttatctggaatgtctcttatctcaccaaccgaacgcgagacaaatagaataaaatacggattaaatgtacttag-----aagatgtttttataattgttg |
362461 |
T |
 |
Q |
186 |
aacttttcaatatccctattttgttggaacaggtagaatacttataatctcaaatttagcacctatcgatctgaaatcgtgaaatactgcaatatcccta |
285 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
362460 |
aacttttcaatatccctattttgttggaacaggtagaatacttataatctcaaatttagcacctatcgatctgaaatcgtgaaatactgcaatatcccta |
362361 |
T |
 |
Q |
286 |
tattgttgga |
295 |
Q |
|
|
| |||||||| |
|
|
T |
362360 |
ttttgttgga |
362351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 590 times since January 2019
Visitors: 6696