View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_68 (Length: 349)
Name: NF0908_low_68
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_68 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 116; Significance: 6e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 116; E-Value: 6e-59
Query Start/End: Original strand, 183 - 332
Target Start/End: Complemental strand, 45616122 - 45615971
Alignment:
| Q |
183 |
gtgcctactaattactcttattgtttagtctatgatttaa-tattttatttttgactgatgtcttaaccacccattttct-taatgatttcttttccaaa |
280 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||| ||| |||||||||||||||| |||||||| ||||||||| ||||||||||||||| ||| |
|
|
| T |
45616122 |
gtgcctactaattactcttaatgtttagtctatgatttaagtatcttatttttgactgatgacttaaccaaccattttctctaatgatttcttttcaaaa |
45616023 |
T |
|
| Q |
281 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatatt |
332 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45616022 |
attctatttctaaaagggcaagctggtatcctactttgaacctagctatatt |
45615971 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 174 times since January 2019
Visitors: 6695