View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_77 (Length: 332)
Name: NF0908_low_77
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_77 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 153; Significance: 5e-81; HSPs: 2)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 153; E-Value: 5e-81
Query Start/End: Original strand, 30 - 190
Target Start/End: Complemental strand, 23434096 - 23433936
Alignment:
| Q |
30 |
attcctacttcttggttcttccctgcaatttctcccaacaagctgggatacccacaaacataataatagttatcttacaaaataactataaaacttttga |
129 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
23434096 |
attcctacttcttggttcttccctgcaatttctcccaacaagctgggatacccgcaaacataataatagttatcttacaaaataactataaaacttttga |
23433997 |
T |
|
| Q |
130 |
ttaattaaagaccctttatttctttaactctagaactagttgaatctcattatgttcttct |
190 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||| |
|
|
| T |
23433996 |
ttaattaaagaccctttatttctttaactctagaactggttgaatctcattatgttcttct |
23433936 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 259 - 320
Target Start/End: Complemental strand, 23433869 - 23433808
Alignment:
| Q |
259 |
cacaagcttaatctcattctattcttcggggtttttggggttagttttgtttgcttaatatt |
320 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
23433869 |
cacaagcttaatctcattctattcttcggggtttctggggttagttttgtttgcttaatatt |
23433808 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 190 times since January 2019
Visitors: 6702