View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_79 (Length: 329)
Name: NF0908_low_79
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_79 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 284; Significance: 1e-159; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 284; E-Value: 1e-159
Query Start/End: Original strand, 13 - 300
Target Start/End: Complemental strand, 51310668 - 51310381
Alignment:
| Q |
13 |
aatatcagacagaatagtaagagccctccgtcacggtctccgtctcctccaccgttccggctccaccttcttcatcttcggcgcaaccggtaacgtctac |
112 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310668 |
aatatcagacagaatagtaagagccctccgtcacggtctccgtctcctccaccgttccggctccaccttcttcatcttcggcgcaaccggtaacgtctac |
51310569 |
T |
|
| Q |
113 |
acagtaaccttatcttccacaccctcgtgcacgtgcccggaccggacaataccatgcaaacacatcctcttcgttatgattcgagtattaggcgtttcac |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310568 |
acagtaaccttatcttccacaccctcgtgcacgtgcccggaccggacaacaccatgcaaacacatcctcttcgttatgattcgagtattaggcgtttcac |
51310469 |
T |
|
| Q |
213 |
aaaacgacgcttgtgtccgtagaaaaaaccttcgaccatgtcatcttcaacgcttgttaaacatgccaacgttgcaagaagcagttgc |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51310468 |
aaaacgacgcttgtgtccgtagaaaaaaccttcgaccatgtcatcttcaacgcttgttaaacatgccaacgttgcaagaagcagttgc |
51310381 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 486 times since January 2019
Visitors: 6696