View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0908_low_91 (Length: 316)
Name: NF0908_low_91
Description: NF0908
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0908_low_91 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 12 - 304
Target Start/End: Complemental strand, 9223153 - 9222864
Alignment:
| Q |
12 |
cagaacctgtgggagaagataatgatcaagccctagatgcagttatgaaactttattctgccttcaaaaataaaaacatacaagaattgtctgagatact |
111 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
9223153 |
cagaaccagtgggagaagataatgatcaagccctagatgcagttatgaaactttattctgccttcaaaaataaaaacatacaagaattgtctgagatact |
9223054 |
T |
|
| Q |
112 |
tgcagatgaatgtagatgtgtgtgcaatttcctctcattcttccaagctttccaaggaaaaacggtatctgctcctattttcagctcattcaacaacaat |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
9223053 |
tgcagatgaatgtagatgtgtgtgcaatttcctctcattcttccaagctttccaaggaaaaacggtatctgctcctattttcagctcattca---acaat |
9222957 |
T |
|
| Q |
212 |
aattgtcttgtttttagctttctacaacaatatttttgcattctcgttagtgacataaattacggtggcaacaataatttacctataacagtt |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
9222956 |
aattgtcttgtttttagctttctacaacaatatttttgcattctggttagtgacataaattacggtggcaacaataatttacctataaaagtt |
9222864 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 762 times since January 2019
Visitors: 6696