View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_high_2 (Length: 276)
Name: NF0909_high_2
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_high_2 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 179; Significance: 1e-96; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 179; E-Value: 1e-96
Query Start/End: Original strand, 37 - 219
Target Start/End: Original strand, 36396949 - 36397131
Alignment:
| Q |
37 |
ataggtgctagagtgctacatgctccaccgtgtctataatgcatggccttctattactggatttgtcagaccatcgtatggttcaacaacaatacttgtt |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36396949 |
ataggtgctagagtgctacatgctccaccgtgtctataatgcatggccttctattactggatttgtcagaccatcgtatggttcaacaacaatacttgtt |
36397048 |
T |
 |
| Q |
137 |
tgggcgtgttaagttttactatataaacctttttggtttcttaatcacaaatcttatttagttaagtttttggtggatacatg |
219 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
36397049 |
tgggcgagttaagttttactatataaacctttttggtttcttaatcacaaatcttatttagttaagtttttggtggatacatg |
36397131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University