View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_10 (Length: 334)
Name: NF0909_low_10
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_10 |
 |  |
|
| [»] chr8 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 101 - 334
Target Start/End: Original strand, 27313072 - 27313305
Alignment:
| Q |
101 |
caaccagtgttccatcaatctggagaaatgcaaatactatgtcagtaattgtaatgatgagtcgctgataaaactaaataattatttttgtgtatgcatc |
200 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313072 |
caaccagtgttccatcaatctggagaaatgcaaataccatgtcagtaattgtaatgaagagtcgctgataaaactaaataattatttttgtgtatgcatc |
27313171 |
T |
 |
| Q |
201 |
acctggatgattagattgtctttacaaggccctatgaatttcgtcgcattaacaaggtaacggcgtccttttggaatcaatagaacagattttggtgtag |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
27313172 |
acctggatgattagattgtctttacaaggccctatgaatttcgtcgcattaacaaggtaacggcgtccttttggaatcaatagaacagattttggtgtag |
27313271 |
T |
 |
| Q |
301 |
aacaagcaactccccatgctttttgaagagccta |
334 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
27313272 |
aacaagcaactccccatgctttttgaagagccta |
27313305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University