View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_15 (Length: 314)
Name: NF0909_low_15
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0909_low_15 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 433728 - 433837
Alignment:
Q |
128 |
ttcaggctgctagattgcataaactatatagaagttgggaggataaccctgatattggcttcgtcatgctcaagggaactggtcgtgcattcgcagctgg |
227 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
433728 |
ttcaggctgctagattgcataaactatatagaagttgggaggataaccctgatattggcttcgtcatgctcaagggaactggtcgtgcattcgcagctgg |
433827 |
T |
 |
Q |
228 |
tggggatatt |
237 |
Q |
|
|
|||||||||| |
|
|
T |
433828 |
tggggatatt |
433837 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University