View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0909_low_15 (Length: 314)

Name: NF0909_low_15
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0909_low_15
NF0909_low_15
[»] chr8 (1 HSPs)
chr8 (128-237)||(433728-433837)


Alignment Details
Target: chr8 (Bit Score: 110; Significance: 2e-55; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 110; E-Value: 2e-55
Query Start/End: Original strand, 128 - 237
Target Start/End: Original strand, 433728 - 433837
Alignment:
128 ttcaggctgctagattgcataaactatatagaagttgggaggataaccctgatattggcttcgtcatgctcaagggaactggtcgtgcattcgcagctgg 227  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
433728 ttcaggctgctagattgcataaactatatagaagttgggaggataaccctgatattggcttcgtcatgctcaagggaactggtcgtgcattcgcagctgg 433827  T
228 tggggatatt 237  Q
    ||||||||||    
433828 tggggatatt 433837  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University