View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_16 (Length: 314)
Name: NF0909_low_16
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0909_low_16 |
 |  |
|
[»] chr5 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 212; Significance: 1e-116; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 212; E-Value: 1e-116
Query Start/End: Original strand, 74 - 314
Target Start/End: Complemental strand, 3811861 - 3811621
Alignment:
Q |
74 |
aaagaagaagtggaaagttagtataaatgtaaaaaattacttaagttttcttcaccataatatctctagtctcttgagggacttgaggtagttgtatgtc |
173 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
T |
3811861 |
aaagaagaagtggaaagttagtataaatgtaaaaaattacttaagttttcttcaccataatatctctagtctcttgagggacttgaggtagttgtatgtc |
3811762 |
T |
 |
Q |
174 |
aagaaagtagaggagatataagcatgaagtgacgaatcacaatttgtgagctatttttgtcnnnnnnncttatattatggttatgcacttgggctatagc |
273 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||| |
|
|
T |
3811761 |
aagaaagtagaggagatataagcatgaagtgacgaatcacaatttgtgagctatttttgtctttttttcttatattatggttatgcacttgggctatagc |
3811662 |
T |
 |
Q |
274 |
ttgatagaaattttctctccaacatcttaccatattatcca |
314 |
Q |
|
|
|||||||||||||| |||||||||||||||||| ||||||| |
|
|
T |
3811661 |
ttgatagaaattttgtctccaacatcttaccatcttatcca |
3811621 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 708 times since January 2019
Visitors: 6705