View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0909_low_17 (Length: 313)

Name: NF0909_low_17
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0909_low_17
NF0909_low_17
[»] scaffold0049 (1 HSPs)
scaffold0049 (90-243)||(58322-58475)


Alignment Details
Target: scaffold0049 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: scaffold0049
Description:

Target: scaffold0049; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 90 - 243
Target Start/End: Complemental strand, 58475 - 58322
Alignment:
90 atattagcctatgctgtagttcgatttgattcaatgactaactaaccattcgtgtcaaagaatatttgcttgttatatctttgtctccaccagagaagaa 189  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
58475 atattagcctatgctgtagttcgatttgattcaatgactaactaaccattcgtgtcaaagaatatttgcttgttatatctttgtctccaccagagaagaa 58376  T
190 agccaaatcccagaattagtaagcagatgcagcttaggcttgaagcaacagcta 243  Q
    |||||||||||||||||||||||||||||||||||||||||||||||| |||||    
58375 agccaaatcccagaattagtaagcagatgcagcttaggcttgaagcaaaagcta 58322  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University