View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_17 (Length: 313)
Name: NF0909_low_17
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_17 |
 |  |
|
| [»] scaffold0049 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: scaffold0049 (Bit Score: 150; Significance: 3e-79; HSPs: 1)
Name: scaffold0049
Description:
Target: scaffold0049; HSP #1
Raw Score: 150; E-Value: 3e-79
Query Start/End: Original strand, 90 - 243
Target Start/End: Complemental strand, 58475 - 58322
Alignment:
| Q |
90 |
atattagcctatgctgtagttcgatttgattcaatgactaactaaccattcgtgtcaaagaatatttgcttgttatatctttgtctccaccagagaagaa |
189 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
58475 |
atattagcctatgctgtagttcgatttgattcaatgactaactaaccattcgtgtcaaagaatatttgcttgttatatctttgtctccaccagagaagaa |
58376 |
T |
 |
| Q |
190 |
agccaaatcccagaattagtaagcagatgcagcttaggcttgaagcaacagcta |
243 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
58375 |
agccaaatcccagaattagtaagcagatgcagcttaggcttgaagcaaaagcta |
58322 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University