View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_20 (Length: 304)
Name: NF0909_low_20
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_20 |
 | |
|
| [»] chr3 (1 HSPs) |
| |
|
Alignment Details
Target: chr3 (Bit Score: 216; Significance: 1e-118; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 216; E-Value: 1e-118
Query Start/End: Original strand, 65 - 304
Target Start/End: Original strand, 34431421 - 34431660
Alignment:
| Q |
65 |
agctgttgctaactcctatatacctttttggccccacaccccacttaactgattaccagaatcacggtgtcatcataattttatcaaaaactattgaaca |
164 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||| || ||| |||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
34431421 |
agctgttgctaactcctatatacctttttggccccacaccccacttaattgtttaacagaatcacggtgtcatcataattttatcaaaaactataaaaca |
34431520 |
T |
|
| Q |
165 |
aaattataatgttatcgtgattctgtcaaattcaccattcggatgagatatatgatatgatacatacttttcattcaaccttccaagcatatagaaacaa |
264 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431521 |
aaattataatgttatcgtgattttgtcaaattcaccattcggatgagatatatgatatgatacatacttttcattcaaccttccaagcatatagaaacaa |
34431620 |
T |
|
| Q |
265 |
gcaatactctgatgaggatgataatgaatcactgacacta |
304 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
34431621 |
gcaatactctgatgaggatgataatgaatcactgacacta |
34431660 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 232 - 279
Target Start/End: Original strand, 43402602 - 43402649
Alignment:
| Q |
232 |
ttttcattcaaccttccaagcatatagaaacaagcaatactctgatga |
279 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||| |||||||||| |
|
|
| T |
43402602 |
ttttcattcaaccttccaagcataaagaaacaagcaaaactctgatga |
43402649 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 968 times since January 2019
Visitors: 6707