View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_22 (Length: 289)
Name: NF0909_low_22
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_22 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 174; Significance: 1e-93; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 174; E-Value: 1e-93
Query Start/End: Original strand, 40 - 245
Target Start/End: Original strand, 11571295 - 11571500
Alignment:
| Q |
40 |
agagcaacatttggaatcactaaggaaacaagaagaactggaaagtaatttgaagaagaaacatgaggaaccttggctgagcaatcaaagacaaatgctg |
139 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11571295 |
agagcaacatttggaatcactaaggaagcaagaagaaatggaaagtaatttgaagaagaaagatgaggaaccttggctgagcaatcaaagacaaatgctg |
11571394 |
T |
|
| Q |
140 |
gactgctatgatagacatgatcaataaaccgcaatcttagagccttagtttcaccccctttacttcttgtttatcttaacttctaatattttgtgccttt |
239 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||| ||| ||||||||||||||||||||||||||||||||||||||||| | | |
|
|
| T |
11571395 |
gactgctatgatggacatgatcaataaaccgcaatcttagagccttagttgcacaccctttacttcttgtttatcttaacttctaatattttgtgcttat |
11571494 |
T |
|
| Q |
240 |
gcttct |
245 |
Q |
| |
|
|||||| |
|
|
| T |
11571495 |
gcttct |
11571500 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 41; Significance: 0.00000000000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 41 - 140
Target Start/End: Original strand, 13305990 - 13306090
Alignment:
| Q |
41 |
gagcaacatttggaatcactaaggaaacaagaagaactggaaagtaatttgaagaagaaacatgaggaacctt-ggctgagcaatcaaagacaaatgctg |
139 |
Q |
| |
|
|||||||| || || || |||||||| |||||||| || ||||| ||| |||||||| |||||||||| ||| |||||||||| ||||||||||||||| |
|
|
| T |
13305990 |
gagcaacacttagagtctctaaggaagcaagaagagctagaaagaaatatgaagaagcaacatgaggagtctttggctgagcaagcaaagacaaatgctg |
13306089 |
T |
|
| Q |
140 |
g |
140 |
Q |
| |
|
| |
|
|
| T |
13306090 |
g |
13306090 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 791 times since January 2019
Visitors: 6705