View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_23 (Length: 285)
Name: NF0909_low_23
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_23 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 148; Significance: 4e-78; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 148; E-Value: 4e-78
Query Start/End: Original strand, 60 - 243
Target Start/End: Complemental strand, 13797490 - 13797307
Alignment:
| Q |
60 |
tagtcttctgtagttttaaggctatgtttggattgatattgtatgatggaatggaattgaatagattagtttgattatnnnnnnnngttgatgctaatga |
159 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
13797490 |
tagtcttctgtagttttaaggctatgtttggattgatagtgtatgatggaatggaattgaatagattagtttgattataaaaaaaagttgatgctaatga |
13797391 |
T |
|
| Q |
160 |
attccatttcactcaaggtatgtaaagtgctaatatatgcaatctgttgtaagctgtttttcctcataatcctaacttcatctc |
243 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |||| |
|
|
| T |
13797390 |
attccatttcactcaaggtatgtaaagtgctaatatatgcaatctgttgtaagctgttttttctcataatcctaacttcttctc |
13797307 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 847 times since January 2019
Visitors: 6697