View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_3 (Length: 441)
Name: NF0909_low_3
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_3 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 166; Significance: 1e-88; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 166; E-Value: 1e-88
Query Start/End: Original strand, 202 - 435
Target Start/End: Complemental strand, 26834060 - 26833831
Alignment:
| Q |
202 |
cagagcattcttatttctcacaatcacagtgccatagctcttacagaaactgaaacccgcaagcannnnnnnnnnnnnnnnnctttcatttttccaacca |
301 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| ||||||||||| |
|
|
| T |
26834060 |
cagagcattcttatttctcacaatcacagtgccatagctcttacagaaactgaaacccgcaagcactctctctctctc----ctttcaattttccaacca |
26833965 |
T |
 |
| Q |
302 |
tttacctgctttgcattgtcattgttctgttctgtctctctttcctttttcattaaggaaccataacatgcttagatcttcaagcatatcaacgttttgt |
401 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
26833964 |
tttacctgctttgcattgtcattgttctgttctgtctctcttttctttttcattaaggaaccataacatgcttagatcttcaagcatatcaacgttttgt |
26833865 |
T |
 |
| Q |
402 |
taatttttctacctcttccacagtttcttttctg |
435 |
Q |
| |
|
||||||||||||||||| |||||||||||||||| |
|
|
| T |
26833864 |
taatttttctacctctttcacagtttcttttctg |
26833831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 114 - 171
Target Start/End: Complemental strand, 26834142 - 26834085
Alignment:
| Q |
114 |
tttatgaggcagtgatagttcagctaaatccactataaaaagcaaacaacgctttaat |
171 |
Q |
| |
|
|||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |
|
|
| T |
26834142 |
tttatgaggcagtgatagttcaactaaatccactataaaaagcaaacaacgctttaat |
26834085 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University