View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_35 (Length: 213)
Name: NF0909_low_35
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_35 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 126; Significance: 4e-65; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 126; E-Value: 4e-65
Query Start/End: Original strand, 1 - 134
Target Start/End: Complemental strand, 34572432 - 34572299
Alignment:
| Q |
1 |
cccttgtagttttgaagaaggcattgcactaatgctgtcaagagataaccaaccagaaagtcctgaaaatttacagggtggtattttagtagataagatt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
34572432 |
cccttgtagttttgaagaaggcattgcactaatgcagtcaagagataaccaaccagaaagtcctgaaaatttgcagggtggtattttagtagataagatt |
34572333 |
T |
|
| Q |
101 |
tatgaagtatctccatacaatcttaatgtagttc |
134 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
34572332 |
tatgaagtatctccatacaatcttaatgtagttc |
34572299 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1468 times since January 2019
Visitors: 6712