View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_36 (Length: 211)
Name: NF0909_low_36
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_36 |
 | |
|
| [»] scaffold0041 (1 HSPs) |
| | |
|
Alignment Details
Target: chr1 (Bit Score: 100; Significance: 1e-49; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 83 - 182
Target Start/End: Complemental strand, 28271508 - 28271409
Alignment:
| Q |
83 |
aggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatggtggaagacatgtcatagg |
182 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
28271508 |
aggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatggtggaagacatgtcatagg |
28271409 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 54; Significance: 3e-22; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 54; E-Value: 3e-22
Query Start/End: Original strand, 83 - 176
Target Start/End: Complemental strand, 40465898 - 40465805
Alignment:
| Q |
83 |
aggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatggtggaagacatgt |
176 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||| ||||||||| | ||||| ||| |||| ||||||||| |||||||||| ||||||| |
|
|
| T |
40465898 |
aggtgtcaagaaatattgacctagtttatggaggaggcagcattggtttgatggggttgatttctcaagctgtttatgatggtggtcgacatgt |
40465805 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0041 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: scaffold0041
Description:
Target: scaffold0041; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 83 - 167
Target Start/End: Original strand, 77217 - 77301
Alignment:
| Q |
83 |
aggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatggtgg |
167 |
Q |
| |
|
|||| ||||| || |||||||| || ||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
77217 |
aggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatggtgg |
77301 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 53; Significance: 1e-21; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 53; E-Value: 1e-21
Query Start/End: Original strand, 83 - 167
Target Start/End: Complemental strand, 40889067 - 40888983
Alignment:
| Q |
83 |
aggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgttcatgatggtgg |
167 |
Q |
| |
|
|||| ||||| || |||||||| || ||||||||||||||||||||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
40889067 |
aggtttcaaggaacattgatcttgtgtatggaggaggaagcattggtctcatgggtttagtttctcaagctgttcatgatggtgg |
40888983 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 46; Significance: 2e-17; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 46; E-Value: 2e-17
Query Start/End: Original strand, 83 - 156
Target Start/End: Original strand, 21625304 - 21625377
Alignment:
| Q |
83 |
aggtgtcaagaaatattgatctagtttatggaggaggaagcattggtctaatgggtttggtttcacaagctgtt |
156 |
Q |
| |
|
|||||||||||||||||||| | |||||||||||||| ||||||||| | ||||| |||||||| ||||||||| |
|
|
| T |
21625304 |
aggtgtcaagaaatattgatttggtttatggaggaggcagcattggtttgatggggttggtttctcaagctgtt |
21625377 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1224 times since January 2019
Visitors: 6711