View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_37 (Length: 209)
Name: NF0909_low_37
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_37 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 146; Significance: 4e-77; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 146; E-Value: 4e-77
Query Start/End: Original strand, 18 - 206
Target Start/End: Complemental strand, 40853909 - 40853718
Alignment:
| Q |
18 |
cttgaatgttttattaaacctaattccctattttgcttatgcaatttcacaagcccatttcttctaatctctatgatgctatcctatgaatcaaaatatg |
117 |
Q |
| |
|
|||| |||||||||||||| | | | |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
40853909 |
cttgtatgttttattaaacattgtgcactattttgcttatgcaatttcacaagcccatttcttctaatctctatgatgctaccctatgaatcaaaatatg |
40853810 |
T |
 |
| Q |
118 |
acattgtattctatgtgc---ttatatttaataatttgcattccagatggatacttaagtgtcatgcctgcttcactgttactgctgaaatt |
206 |
Q |
| |
|
|||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
40853809 |
acattgtattctatgtgcttattatatttattaatttgcattccagatggatacttaagtgtcatgcctgcttcactgttactgctgaaatt |
40853718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 46 - 206
Target Start/End: Complemental strand, 40858290 - 40858131
Alignment:
| Q |
46 |
tattttgcttatgcaatttcacaagcccatttcttctaatctctatgatgctatcctatgaatcaaaatatgacattgtattctatgtgcttatattt-a |
144 |
Q |
| |
|
|||| |||| ||||||||||||| ||| ||||||| |||||||| ||| |||||||| ||| || |||||| ||||||| || |||||||| ||| | |
|
|
| T |
40858290 |
tattatgctcatgcaatttcacatgcctatttcttataatctct--gatactatcctacgaagcacaatatgctgttgtattttacgtgcttatctttta |
40858193 |
T |
 |
| Q |
145 |
ataatttgcattccagatggatacttaagtgtcatgcctgcttcactgttactgctgaaatt |
206 |
Q |
| |
|
|| |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
40858192 |
attatttgcattccagatggatactcaagtgtcatgcctgcttcactgttactgctgaaatt |
40858131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University