View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_41 (Length: 202)
Name: NF0909_low_41
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0909_low_41 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 8 - 183
Target Start/End: Complemental strand, 42946339 - 42946163
Alignment:
Q |
8 |
cttttttcaactttacatttatggttgagtgcaggagtggggaaaggatttggtactgagaataagtgctgattaatttaattaagctaattttgattag |
107 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||| |
|
|
T |
42946339 |
cttttttcaactttacatttatggttgagtgcaggagtggggaaaggatttggtactgagaataagtgctgcttaatttaattatgctaattttgattag |
42946240 |
T |
 |
Q |
108 |
gtgggatcaggtgccataatttcttccctaacctgattc-taaaatcaacaaacatcttcatgtcacatattatcaa |
183 |
Q |
|
|
||||||||||||||| ||||||||||||||||||||||| |||||||||||| ||||||||||||||||| |||||| |
|
|
T |
42946239 |
gtgggatcaggtgccgtaatttcttccctaacctgattcttaaaatcaacaaccatcttcatgtcacatactatcaa |
42946163 |
T |
 |
Back To:
[
HSP Overview ] [
Target Overview ] [
Alignment Overview ]
© Oklahoma State University