View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_8 (Length: 341)
Name: NF0909_low_8
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_8 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 245; Significance: 1e-136; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 245; E-Value: 1e-136
Query Start/End: Original strand, 1 - 257
Target Start/End: Original strand, 19476855 - 19477111
Alignment:
| Q |
1 |
atggtcaaatgatcaaggtttggatacattgttttatggtgaatatgaaaattatggacctggttcaaagattgataatcgtgttgaatgggttggttat |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19476855 |
atggtcaaatgatcaaggtttggatacattgttttatggtgaatatgaaaattatggacctggttcaaagattgataatcgtgttgaatgggttggttat |
19476954 |
T |
 |
| Q |
101 |
catttgatggattataatgatgcttataatttcagtgtttctgagtttattattggtgatcaatggcttgagtctacttcagttccttatgatgatggaa |
200 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
19476955 |
catttgatggattataatgatgcatataatttcagtgtttctgagtttattattggtgatcaatggcttgagtctacttcagttccttatgatgatggaa |
19477054 |
T |
 |
| Q |
201 |
tttgacatagaaaagataatgtaactttggtttgttacatttttcattaatattatt |
257 |
Q |
| |
|
||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||| |
|
|
| T |
19477055 |
tttgacatagaaaagataatgtaactttggttttttacatttttcattaatgttatt |
19477111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 23 - 67
Target Start/End: Complemental strand, 1623280 - 1623236
Alignment:
| Q |
23 |
gatacattgttttatggtgaatatgaaaattatggacctggttca |
67 |
Q |
| |
|
|||||||||| |||||| || |||||||| ||||||||||||||| |
|
|
| T |
1623280 |
gatacattgtattatggagagtatgaaaactatggacctggttca |
1623236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University