View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0909_low_9 (Length: 339)
Name: NF0909_low_9
Description: NF0909
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0909_low_9 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 190; Significance: 1e-103; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 190; E-Value: 1e-103
Query Start/End: Original strand, 60 - 331
Target Start/End: Complemental strand, 42394149 - 42393878
Alignment:
| Q |
60 |
tcatagggaagccgaacttgtcggannnnnnnccttcgttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttga |
159 |
Q |
| |
|
|||||||||||||||||||||| || ||| || ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42394149 |
tcatagggaagccgaacttgtcagatttttttcctgcgctggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttga |
42394050 |
T |
|
| Q |
160 |
tggaatatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggaaagtgaaagtaaggannnnnnnnnnnnnnngttgaatttgaag |
259 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
42394049 |
tggaatatttgaaaagatgattggtgaacgaatggtgaaggatgtagaaggaaaggagagtgaaagtaaggattttttgcagtttttgttgaatttgaag |
42393950 |
T |
|
| Q |
260 |
gaggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttgt |
331 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42393949 |
gaggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttgt |
42393878 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 66; E-Value: 4e-29
Query Start/End: Original strand, 97 - 190
Target Start/End: Complemental strand, 42378197 - 42378104
Alignment:
| Q |
97 |
gttggctcggtttgatttgcagggtattgtgaaagatatgaatcttttggtgcctcgttttgatggaatatttgaaaagatgattggtgaacga |
190 |
Q |
| |
|
|||||| |||||||||||||||||| ||||||||||||||||| |||||||||||| |||||||| |||||||| |||||||||||||||||| |
|
|
| T |
42378197 |
gttggcccggtttgatttgcagggtgttgtgaaagatatgaatgctttggtgcctcgctttgatgggatatttgagaagatgattggtgaacga |
42378104 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 37; E-Value: 0.000000000008
Query Start/End: Original strand, 247 - 331
Target Start/End: Complemental strand, 42378044 - 42377960
Alignment:
| Q |
247 |
gttgaatttgaaggaggaaggtgattccaagacaccattcacaagcacccacgtgaaggctcttctcctggtatgctacctttgt |
331 |
Q |
| |
|
|||||||||||||||||| |||||||| |||||||| || |||| || || || |||||||| ||| ||||||||||| ||||| |
|
|
| T |
42378044 |
gttgaatttgaaggaggagggtgattctaagacaccgtttacaaatactcatgttaaggctctactcatggtatgctacttttgt |
42377960 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 27 times since January 2019
Visitors: 6700