View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0910_high_5 (Length: 268)

Name: NF0910_high_5
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0910_high_5
NF0910_high_5
[»] chr4 (1 HSPs)
chr4 (80-241)||(51358336-51358497)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 80 - 241
Target Start/End: Original strand, 51358336 - 51358497
Alignment:
80 atattaacatcaaacttaatgatggttgacgggattaactcttgaaaatggaaagaggaagatggaagatatgataatgnnnnnnnntacagattttgat 179  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||        |||||||||||||    
51358336 atattaacatcaaacttaatgatggttgacgggattaactcttgaaaatggaaagaggaagatggaagatatgatagtgaaaaaaaatacagattttgat 51358435  T
180 ctttggttttgtaaaacaaactttttaagtataaatatttcaaaaacgtctcttaccctatg 241  Q
    || ||||||||||||||||||||||||| ||||||||||||||||||||||||||| |||||    
51358436 ctatggttttgtaaaacaaactttttaattataaatatttcaaaaacgtctcttactctatg 51358497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 610 times since January 2019
Visitors: 6696