View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0910_low_11 (Length: 279)
Name: NF0910_low_11
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0910_low_11 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 189; Significance: 1e-102; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 189; E-Value: 1e-102
Query Start/End: Original strand, 34 - 230
Target Start/End: Original strand, 1333872 - 1334068
Alignment:
| Q |
34 |
gtgagatgaaaatagcttacaaaataagctaaatagtacagaaatgtcccgaactttttcataagatcgtcgaaacacttaattgactttgcttaatttg |
133 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
1333872 |
gtgagatgaaaatagcttacaaaataagctaaatagtacagaaatgtcccgaactttttcataagatcatcgaaacacttaattgactttgcttaatttg |
1333971 |
T |
|
| Q |
134 |
tccatataagttctttcaaacgtgtctgagtggtttttgttatattattgcgtttttcaggtacattctcatgttgatatatataattttgatgatg |
230 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
1333972 |
tccatataagttctttcaaacatgtctgagtggtttttgttatattattgcgtttttcaggtacattctcatgttgatatatataattttgatgatg |
1334068 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 885 times since January 2019
Visitors: 6705