View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0910_low_12 (Length: 274)
Name: NF0910_low_12
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0910_low_12 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 194; Significance: 1e-105; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 194; E-Value: 1e-105
Query Start/End: Original strand, 1 - 223
Target Start/End: Complemental strand, 37059673 - 37059449
Alignment:
| Q |
1 |
ccttttacggatttaactcgtatcctagattgctcgttgaattcatttgttgtggacaaaatattttgaatcaacggtac--ctctgacaatgttattat |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||| ||||||||||||||||| ||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
37059673 |
ccttttacggatttaactcgtatcctagattgttcgttcaattcatttgttgtggagaaactattttgaatcaacggtacacctctgacaatgttattat |
37059574 |
T |
 |
| Q |
99 |
ttacaagaaattgttcacggtatatagaagtctaagaagaagggtgatgttgctttcaagtttcaagcttgatttggaaaaacctttgacaatgttaatg |
198 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37059573 |
ttacaagaaattgttcacggtatatagaagtctaagaagaagggtgatgttgctttcaagtttcaagcttgatttggaaaaacctttgacaatgttaatg |
37059474 |
T |
 |
| Q |
199 |
actatttggtatgagatattattcg |
223 |
Q |
| |
|
|||||||||||||||||||| |||| |
|
|
| T |
37059473 |
actatttggtatgagatattgttcg |
37059449 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 31; Significance: 0.00000002; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 9 - 75
Target Start/End: Original strand, 5473610 - 5473676
Alignment:
| Q |
9 |
ggatttaactcgtatcctagattgctcgttgaattcatttgttgtggacaaaatattttgaatcaac |
75 |
Q |
| |
|
|||||||||| ||||||||||||||| |||| || ||||||||||| ||||||||| ||||||| |
|
|
| T |
5473610 |
ggatttaacttgtatcctagattgctttttgagtttgtttgttgtggagaaaatatttcaaatcaac |
5473676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 30; Significance: 0.00000009; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 30; E-Value: 0.00000009
Query Start/End: Original strand, 10 - 75
Target Start/End: Complemental strand, 30638924 - 30638859
Alignment:
| Q |
10 |
gatttaactcgtatcctagattgctcgttgaattcatttgttgtggacaaaatattttgaatcaac |
75 |
Q |
| |
|
||||||||| ||||||||||||||||| || || |||||||||| | ||| |||||| ||||||| |
|
|
| T |
30638924 |
gatttaacttgtatcctagattgctcgccgagtttatttgttgtgaagaaactattttaaatcaac |
30638859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 2 - 74
Target Start/End: Complemental strand, 1914185 - 1914113
Alignment:
| Q |
2 |
cttttacggatttaactcgtatcctagattgctcgttgaattcatttgttgtggacaaaatattttgaatcaa |
74 |
Q |
| |
|
|||||| | ||||||||||| | ||| ||||||||| | ||||||||||||||| ||| ||||| ||||||| |
|
|
| T |
1914185 |
cttttaagaatttaactcgtgttctaaattgctcgtccagttcatttgttgtggagaaactatttcgaatcaa |
1914113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University