View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0910_low_14 (Length: 268)
Name: NF0910_low_14
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0910_low_14 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 122; Significance: 1e-62; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 122; E-Value: 1e-62
Query Start/End: Original strand, 80 - 241
Target Start/End: Original strand, 51358336 - 51358497
Alignment:
| Q |
80 |
atattaacatcaaacttaatgatggttgacgggattaactcttgaaaatggaaagaggaagatggaagatatgataatgnnnnnnnntacagattttgat |
179 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| || ||||||||||||| |
|
|
| T |
51358336 |
atattaacatcaaacttaatgatggttgacgggattaactcttgaaaatggaaagaggaagatggaagatatgatagtgaaaaaaaatacagattttgat |
51358435 |
T |
|
| Q |
180 |
ctttggttttgtaaaacaaactttttaagtataaatatttcaaaaacgtctcttaccctatg |
241 |
Q |
| |
|
|| ||||||||||||||||||||||||| ||||||||||||||||||||||||||| ||||| |
|
|
| T |
51358436 |
ctatggttttgtaaaacaaactttttaattataaatatttcaaaaacgtctcttactctatg |
51358497 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 572 times since January 2019
Visitors: 6704