View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0910_low_19 (Length: 206)
Name: NF0910_low_19
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0910_low_19 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 191; Significance: 1e-104; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 191; E-Value: 1e-104
Query Start/End: Original strand, 1 - 203
Target Start/End: Original strand, 13283597 - 13283799
Alignment:
| Q |
1 |
acgcagcagtcaatctcagcaatgatttgagatcgatcaacttatattacaccttcactaaatcatcaacaaatcattttcaccactggtttcagatcag |
100 |
Q |
| |
|
||||| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13283597 |
acgcatcagtcaatctcagcaatgatttgagatcgatcaacttacattacaccttcactaaatcatcaacaaatcattttcaccactggtttcagatcag |
13283696 |
T |
 |
| Q |
101 |
accgccaaaatcattaaccgcgtgacacaattatcgtgtctagtccaaatatgattgatggttactggttacctcatgccagtatgtttcatgatatttg |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
13283697 |
accgccaaaatcattaaccgcgtgacacaattatcgtgtctagtccaaatatgattgatggttactggttacatcatgccagtatgtttcatgatatttg |
13283796 |
T |
 |
| Q |
201 |
cat |
203 |
Q |
| |
|
||| |
|
|
| T |
13283797 |
cat |
13283799 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University