View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0910_low_21 (Length: 203)
Name: NF0910_low_21
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0910_low_21 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 77; Significance: 6e-36; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 1 - 81
Target Start/End: Complemental strand, 50710259 - 50710179
Alignment:
Q |
1 |
catcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatattcatctca |
81 |
Q |
|
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |
|
|
T |
50710259 |
catcatattctcgtcggcaaaacttcatcgtctcacaaagtgatcgaagcaacaacagtcattttctcaatatacatctca |
50710179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 1159 times since January 2019
Visitors: 6711