View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0910_low_4 (Length: 417)
Name: NF0910_low_4
Description: NF0910
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0910_low_4 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 226; Significance: 1e-124; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 226; E-Value: 1e-124
Query Start/End: Original strand, 73 - 333
Target Start/End: Complemental strand, 31013403 - 31013142
Alignment:
| Q |
73 |
gaagcaaaggtggggaaatgatgcatctcactgccatgatggtgtggaagaagaattttgccacctccatgacggtgagaggatgaccctttatacaacc |
172 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31013403 |
gaagcaaagctggggaaatgatgcatctcactgccatgatggtgtggaagaagaattttgccacctccatgacggtgagaggatgaccctttatacaacc |
31013304 |
T |
|
| Q |
173 |
ctggtgaggcagatgttatatttctctctcatttgaggttgattatgaatcagtgtgatgaggttgcaaagga-gctatatagtgttgattttgcctctg |
271 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||| | || ||||||||| ||||| ||||| |
|
|
| T |
31013303 |
ctggtgaggcagatgttatgtttctctctcatttgaggttgattatgaatcagtgtgatgaggttgcaaaggaggatacatagtgttgtttttgtctctg |
31013204 |
T |
|
| Q |
272 |
aattgtggcagagaattctctttacttggttaaggctaaacttaacaagaaggggatgatga |
333 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
31013203 |
aattgtggcagagaattctctttacttggttaacgctaaacttaacaagaaggggatgatga |
31013142 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University
This website was viewed 358 times since January 2019
Visitors: 6696