View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0911_high_5 (Length: 261)
Name: NF0911_high_5
Description: NF0911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF0911_high_5 |
 |  |
|
| [»] chr3 (1 HSPs) |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 229; Significance: 1e-126; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 229; E-Value: 1e-126
Query Start/End: Original strand, 29 - 261
Target Start/End: Original strand, 51668431 - 51668663
Alignment:
| Q |
29 |
atgaaaaacctcctcttcttctccagatggttcgtgactccgaagatattaaattcatgtaaggtttattgttcggctggtttgattttcgcaacttgct |
128 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51668431 |
atgaaaaacctcctcttcttctccagatggttcgtgactccgaagatattaaattcatgtaaggtttattgttcggctggtttgattttcgcaacttgct |
51668530 |
T |
 |
| Q |
129 |
tatggtttagaaactgaatcatgaacaaacaacatattaaatctctttctctacaggtctgctttacggtccttcaaacgccgcgttgcctatgcaaata |
228 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||| |
|
|
| T |
51668531 |
tatggtttagaaactgaatcatgaacaaacaacatattaaatctctttctctacaggtctgctttacggtccttcaaacgccgcgttgcttatgcaaata |
51668630 |
T |
 |
| Q |
229 |
ttcgttatgaccgtatccttttgttttagttca |
261 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
51668631 |
ttcgttatgaccgtatccttttgttttagttca |
51668663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University