View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0911_low_4 (Length: 364)

Name: NF0911_low_4
Description: NF0911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0911_low_4
NF0911_low_4
[»] chr7 (1 HSPs)
chr7 (160-284)||(35468209-35468333)


Alignment Details
Target: chr7 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 160 - 284
Target Start/End: Complemental strand, 35468333 - 35468209
Alignment:
160 gtcaaacttaattggcttggcaagatgtatttaaaatctatcacttcttttgaatggccattatcatataggatttgctccgcggcacaaaatcttctca 259  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||    
35468333 gtcaaacttaattggcttggcaagatgtatttaaaatctatcacttcttttgaatggccattatcatataggatttgctctgcggcacaaaatcttctca 35468234  T
260 ttaaatgaagtaaccaaaaacccac 284  Q
    |||||||||||||||||||| ||||    
35468233 ttaaatgaagtaaccaaaaatccac 35468209  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 210 times since January 2019
Visitors: 6695