View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0911_low_4 (Length: 364)
Name: NF0911_low_4
Description: NF0911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0911_low_4 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 117; Significance: 2e-59; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 117; E-Value: 2e-59
Query Start/End: Original strand, 160 - 284
Target Start/End: Complemental strand, 35468333 - 35468209
Alignment:
Q |
160 |
gtcaaacttaattggcttggcaagatgtatttaaaatctatcacttcttttgaatggccattatcatataggatttgctccgcggcacaaaatcttctca |
259 |
Q |
|
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||| |
|
|
T |
35468333 |
gtcaaacttaattggcttggcaagatgtatttaaaatctatcacttcttttgaatggccattatcatataggatttgctctgcggcacaaaatcttctca |
35468234 |
T |
 |
Q |
260 |
ttaaatgaagtaaccaaaaacccac |
284 |
Q |
|
|
|||||||||||||||||||| |||| |
|
|
T |
35468233 |
ttaaatgaagtaaccaaaaatccac |
35468209 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University