View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF0911_low_8 (Length: 317)

Name: NF0911_low_8
Description: NF0911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF0911_low_8
NF0911_low_8
[»] chr4 (1 HSPs)
chr4 (109-185)||(18929068-18929144)


Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 109 - 185
Target Start/End: Original strand, 18929068 - 18929144
Alignment:
109 aaagacatgcgtatactaaattgagattggatctagtagaatgagttaaactcttataatatgacaaatcaaagttt 185  Q
    ||||||||  ||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| ||||    
18929068 aaagacatatgtagactaaattgagattggttctagtagaatgagttaaactcttataatgtgacaaatcaaggttt 18929144  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University

This website was viewed 155 times since January 2019
Visitors: 6695