View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
Legend |
| Query |
| Query hiting target |
| Query hiting target's complemental strand |
| Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF0911_low_8 (Length: 317)
Name: NF0911_low_8
Description: NF0911
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
[»] NF0911_low_8 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 109 - 185
Target Start/End: Original strand, 18929068 - 18929144
Alignment:
Q |
109 |
aaagacatgcgtatactaaattgagattggatctagtagaatgagttaaactcttataatatgacaaatcaaagttt |
185 |
Q |
|
|
|||||||| ||| |||||||||||||||| ||||||||||||||||||||||||||||| ||||||||||| |||| |
|
|
T |
18929068 |
aaagacatatgtagactaaattgagattggttctagtagaatgagttaaactcttataatgtgacaaatcaaggttt |
18929144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University